Am. J. Bot. Cross-Journal Searching
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.
Agricola
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.
(American Journal of Botany. 2000;87:634-641.)
© 2000 Botanical Society of America, Inc.

LEAFY and the evolution of rosette flowering in violet cress (Jonopsidium acaule, Brassicaceae)1

Guoping Shu2,0, Weber Amaral3,0, Lena C. Hileman0 and David A. Baum4,0

0 Department of Organismic and Evolutionary Biology, Harvard University Herbaria, 22 Divinity Avenue, Cambridge, Massachusetts 02138, USA

Received for publication March 25, 1999. Accepted for publication August 24, 1999.

ABSTRACT

Arabidopsis and most other Brassicaceae produce an elongated inflorescence of mainly ebracteate flowers. However, the early-flowering species violet cress (Jonopsidium acaule) and a handful of other species produce flowers singly in the axils of rosette leaves. In Arabidopsis the gene LEAFY (LFY) is implicated in both the determination of flower meristem identity and in the suppression of leaves (bracts) that would otherwise subtend the flowers. In this study we examined the role of LFY homologs in the evolution of rosette flowering in violet cress. We cloned two LFY homologs, vcLFY1 and vcLFY2, from violet cress. Their exon sequences show ~90% nucleotide similarity with Arabidopsis LFY and 99% similarity to each other. We used in situ hybridization to study vcLFY expression in violet cress. The patterns were very similar to LFY in Arabidopsis except for stronger expression in the shoot apical meristem outside of the region of flower meristem initiation. It is possible that the relatively diffuse expression of vcLFY contributes to the lack of bract suppression in violet cress. Additionally, the earliest flowers produced by violet cress express vcLFY, suggesting that accelerated flowering in violet cress could also result from changes in the regulation of vcLFY.

Key Words: Arabidopsis • Brassicaceae • evolution of development • flowering • gene expression • inflorescence • in situ hybridization • LEAFY

The placement of flowers on a plant has profound ecological significance. It is, therefore, desirable that we understand how flower disposition is regulated in a given species and how it becomes modified in the course of evolution. The approach taken in this paper is to compare a well-studied model system, Arabidopsis [Arabidopsis thaliana (L.)Heynh.], with another member of Brassicaceae, violet cress [Jonopsidium acaule (Desf.)Rchb.]. Whereas Arabidopsis flowers are borne on elongated, leafless, inflorescences, violet cress flowers emerge from the axils of rosette leaves (Figs. 12). Here we explore the possible role of a floral meristem identity gene, LEAFY (LFY), in the evolution of rosette flowering.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Violet cress morphology. (A) Photograph of a flowering violet cress plant. Scale bar = 1 cm. (B) Scanning electron micrograph of the shoot apical meristem of a flowering plant. Scale bar = 100 µm. Figure Abbreviations: b, bract primordium; b/f, combined bract/flower primordium; f, flower primordium; pc, paraclade; sam, shoot apical meristem; st, stipule.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Schematic diagrams of plant architecture. (A) Violet cress. (B) Arabidopsis. Ovals = cotyledons, curved lines = leaves, circles = flowers, open arrows = paraclades, and closed arrows = primary shoot apical meristems

 
The vegetative phase of development in Arabidopsis, violet cress, and almost all other Brassicaceae involves the formation of a rosette: a series of spirally arranged leaves with relatively short internodes. The meristems in the axils of these rosette leaves have the potential to produce new shoots called paraclades. The transition to flowering in most Brassicaceae (but not violet cress) results in the shoot apical meristem switching from producing leaves (with quiescent paraclades) to producing flowers without subtending leaves (Hempel and Feldman, 1994 ). Soon after the onset of flower production, the internodes of the primary axis elongate, carrying upward the flowers and the youngest leaves ("cauline leaves"). Flowering generally also results in the derepression of the distalmost paraclades, such that they elongate and start producing lateral flowers (Hempel and Feldman, 1994 ). The elongated portion of the plant, including the upper paraclades and the flowering axis, is usually termed an "inflorescence" (see Weberling [1989 ] for refined terminology).

Violet cress is one of a few rosette flowering species of Brassicaceae (Fig. 1). In such plants reproduction begins early and flowers are produced in the axils of leaves, which are indistinguishable from the leaves that precede flowering. We will use the term bract for any leaf subtending a flower and the term bracteate (vs. ebracteate) to describe flowers that are associated with a bract. One interpretation of the violet cress pattern is that solitary flowers are produced from the rosette rather than on an inflorescence. However, the fact that we use the appellation "rosette flowering" should not be taken as a rejection of two other equally valid interpretations: (1) bracteate flowers are produced on a compressed inflorescence; or (2) each flower is a reduced paraclade with a single, terminal flower. Regardless of which of these models is favored, we need to explain three distinct features of rosette flowering: precocious reproduction, the lack of bract suppression, and reduced internode elongation. In this paper, we focus on the possible genetic basis of the first two of these phenomena.

The strategy we have taken to elucidate the genetic basis of rosette flowering in violet cress is to identify candidate genes based on the extensive knowledge of the genetic regulation of floral meristem identity in Arabidopsis (e.g., Weigel, 1995 ; Yanofsky, 1995 ; Simon, Igeño, and Coupland, 1996; Bradley et al., 1996, 1997 ; Lee et al., 1997 ; Ruiz-García et al., 1997 ; Blázquez et al., 1997, 1998 ; Parcy et al., 1998 ; Busch, Bomblies, and Weigel, 1999 ). There are several genes that might play a role in the origin of rosette flowering (e.g., TERMINAL FLOWER 1; APETALA 1). However, one obvious candidate gene is LFY because Arabidopsis plants overexpressing LFY show precocious flowering (Weigel and Nilsson, 1995 ; Blázquez et al., 1997 ) and the formation of flowers in the axils of rosette leaves (Weigel and Nilsson, 1995 ; Wagner, Sablowski, and Meyerowitz, 1999 ). This shows that changes in LFY activity or expression could contribute to the evolution of rosette flowering.

In Arabidopsis, lfy mutants fail to produce normal flowers (Schultz and Haughn, 1991 ; Huala and Sussex, 1992 ; Weigel et al., 1992 ). In other species where mutants in LFY homologs are available, flower formation is similarly disrupted (Coen et al., 1990 ; Hofer et al., 1997 ; Souer et al., 1998 ). Likewise, plants overexpressing LFY genes produce ectopic flowers (Weigel and Nilsson, 1995 ; Souer et al., 1998 ). Thus, despite species-to-species variation in their expression (see Coen et al., 1990 ; Weigel et al., 1992 ; Anthony, James, and Jordan, 1993 ; Kelly, Bonnlander, and Meeks-Wagner, 1995 ; Weigel and Nilsson, 1995 ; Hofer et al., 1997 ; Pouteau et al., 1997 ; Kyozuka et al., 1998 ; Souer et al., 1998 ), LFY homologs appear to play a conserved role in the regulation of flower meristem formation (Weigel and Nilsson, 1995 ). Additionally, LFY has been implicated in the suppression of bracts in Arabidopsis (Coen and Nugent, 1994 ).

Models of the function of LFY (e.g., Schultz and Haughn, 1991 ; Weigel et al., 1992 ; Weigel and Nilson, 1995 ; Parcy et al., 1998 ) suggest that its transcription is activated by exogenous factors (e.g., daylength, vernalization) and endogenous factors (a developmental clock) via hormones such as gibberellic acid (Blázquez et al., 1998 ) and several flowering-time genes (as reviewed in Weigel, 1995 ; Levy and Dean, 1998 ). LFY protein then binds to the promoters of target genes (especially, APETALA 1, APETALA 3, and AGAMOUS) and, in the presence of necessary coregulators, causes shoot meristems to differentiate into flowers (Lee et al., 1997 ; Parcy et al., 1998 ; Busch, Bomblies, and Weigel, 1999 ; Wagner, Sablowski, and Meyerowitz, 1999 ).

Violet cress is one of five species in the genus Jonopsidium Reichenb. (Heywood, 1992 ; Morales, 1993 ). These species are annual herbs growing in North Africa, Spain, Portugal, and Italy. Within Jonopsidium, three species produce an inflorescence in which most (but not all) flowers are ebracteate, whereas two species (J. acaule and J. albiflorum Durieu) are fully bracteate (Heywood, 1992 ). Violet cress (J. acaule) is thought to originate from Portugal but is cultivated as a garden ornamental (Heywood, 1992 ). Molecular phylogenetic analyses have confirmed that the genus Jonopsidium is closely related to an inflorescence-bearing, Mediterranean genus, Cochlearia (Zunk et al., 1996 ). This suggests that violet cress represents a lineage that evolved rosette flowering from an inflorescence-bearing ancestor.

MATERIALS AND METHODS

Plant materials
Seeds of violet cress were obtained from the Colección de Germplasma de Crucíferas, Instituto Nacional de Investigaciones Agrarias, Madrid, Spain (accession number 496–1782–83, from Utrecht Botanical Garden). A voucher specimen of our cultivated lines (Baum 373) is deposited in the Gray Herbarium (Harvard University). Seeds for Arabidopsis, ecotype landsberg erecta, were obtained from the Arabidopsis Biological Resource Center (Ohio State University). Seeds were surface-sterilized and planted on agar plates in minimum Murashige and Skoog medium (Sigma, St. Louis, Missouri, USA). The plates were treated at 4°C for 1 wk and then were transferred to a growth chamber with 16 h of light and 8 h of dark, under a light density of 140–153 µmol·m-2·s-1, at 21°C during the daylight cycle and 17°C during the dark cycle. One-week-old seedlings were transplanted into pots.

Exogenous application of gibberellic acid has been shown to influence LFY expression (Blázquez et al., 1998 ). To investigate whether there is a similar effect in violet cress, some plants were surface sprayed twice a week with 100 µmol/L gibberellic acid (GA3 Sigma, St. Louis, Missouri, USA) in 10 mmol/L Tris-HCl (pH 8.0).

Scanning electron microscopy (SEM)
Shoot apical meristems of flowering violet cress plants were fixed in FAA (formalin-acetic acid-alcohol) and stored in 70% ethanol at 4°C. Shoot tips were dehydrated in a series of ethanols, critical-point dried, and sputter-coated with gold-palladium. SEM was conducted using an Amray AMR model 100 microscope. Images were scanned and backgrounds were blackened using Adobe Photoshop 5.0 (Adobe Systems, Inc., Mountain View, California, USA).

Amplification, cloning, and sequencing
A ~3 kilobasepair (kbp) fragment of LFY was amplified (eLONGase kit; Gibco BRL, Gaithersburg, Maryland, USA) from violet cress genomic DNA using primers 001F (ATGGATCCTGAAGGTTTCACG) and 1198R (ACAGCTAATACCGCCAACTAA) designed based on published sequences of LFY homologs. The single product (~3 kbp) was purified and cloned using the pGEM-T Easy Vector (Promega, Madison, Wisconsin, USA). Five clones were purified and sequenced using internal primers designed from published LFY sequences and by primer walking. Cleaned cycle-sequencing reactions (BigDye; PE Applied Biosystems, Foster City, California, USA) were visualized on an ABI 377 automated DNA sequencer (PE Applied Biosystems, Foster City, California, USA). Sequences were assembled and edited using Sequencher 3.0 (Gene Codes Inc., Ann Arbor, Michigan, USA).

In situ hybridization
Plants harvested at various developmental stages were fixed in 4% paraformaldehyde for 24 h. At the time of fixation the stage of development was determined by counting the number of visible (>2 mm) leaves (excluding cotyledons). Fixed plants were dissected and embedded in paraffin (Paraplast+; Oxford Labware, St. Louis, Missouri, USA). A microtome was used to cut sections at 6 µm. These were mounted on Poly-D-lysine coated slides and then dewaxed in xylene (three washes of 10 min at room temperature).

We used antisense and sense riboprobes derived from an Arabidopsis LFY cDNA clone (Weigel et al., 1992 ) and from violet cress LFY (vcLFY) exons. The latter probe was generated by amplifying exons I and III of vcLFY and subcloning the PCR products into the TA PCR-cloning vector (Invitrogen, Carlsbad, California, USA). For all the probes, digoxigenin-labeled sense and antisense probes were synthesized from the clones by in vitro transcription using SP6 and T7 RNA polymerases (Boehringer-Mannheim, Indianapolis, Indiana, USA). The violet cress probe used for in situ hybridization was an equimolar mix of the exon I and exon III probes.

Probe hydrolysis, prehybridization, and hybridization were modified from Shu et al. (in press). Proteinase K treatment used 20 µg/mL for 20 min at 37°C, and RNase A treatment used 5 µg/mL for 20 min at 37°C. Each millilitre of prehybridization/hybridization solution contained: 125 µL 10X in situ hybridization buffer (3.0 mol/L NaCl, 0.1 mol/L Tris pH 6.8, 0.1 mol/L Na phosphate pH 6.8, 50 mmol/L EDTA), 500 µL deionized formamide, 250 µL 50% dextran sulfate, 25 µL 20 mg/mL tRNA, 60 µL 5 mg/mL poly A, and 40 µL ddH2O. Hybridization was run at 52°C overnight. A range of post-hybridization washing stringencies were used, the highest being 0.25 x SSC at 42°C for 30 min. Immunolocalization and colorimetric detection used color substrates NBT and X-phosphate (Boehringer-Mannheim, Indianapolis, Indiana, USA). Sections were observed using an Olympus BX60 compound microscope under dark-field. Image resizing and background masking was carried out using Adobe Photoshop 5.0 (Adobe Systems Inc., Mountain View, California, USA).

RESULTS

Shoot morphological development
Once flowering commenced in violet cress (usually at about node 9), all subsequent nodes produced both a flower and a subtending bract (Fig. 1A). These paired structures appeared as a single bulge on the flanks of the shoot apical meristem. Soon afterwards, however, paired primordia could be distinguished: an apical flower primordium and a more basal bract primordium (Fig. 1B). As they matured, leaves and bracts developed a pair of linear stipules (Fig. 1B). Violet cress flowers were observed to pass through a similar series of developmental stages to those defined for Arabidopsis by Smyth, Bowman, and Meyerowitz (1990) .

Isolation of LEAFY homologs
Alignment of the five clone sequences with Arabidopsis LFY (Weigel et al., 1992 ) showed that they were LFY homologs, here named vcLFY. Intron/exon boundaries were inferred based on intron positions in LFY (Wiegel et al., 1992 ). The inferred exons of vcLFY and LFY showed 90% nucleotide identity and 91.5–92.3% amino acid identity (Fig. 3). In addition, there were seven inferred single amino acid insertion/deletion events separating vcLFY and LFY. Most of the divergence in inferred protein sequence was localized in the proline-rich domain of exon I and the acidic domain of exon II (Weigel et al., 1992 ; Fig. 3). There was perfect conservation of amino acid sequence in the second half of exon II and in exon III, suggesting that these regions have been under the strongest selective constraint. The vcLFY and LFY intron sequences were so divergent that alignment was impossible.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. (A) Alignment of the inferred amino acid sequences of LFY and vcLFY. (B–C) Alignment of introns I (B) and II (C) for vcLFY1, vcLFY2, and the putative hybrid sequence vcLFY1/2. Arabidopsis LFY was too divergent to include in intron alignments. Note that vcLFY1/2 resembles vcLFY1 for intron I but vcLFY2 for intron II

 
Three of the five sequenced clones fell into a class, here named vcLFY1. These three vcLFY1 clones differed from their shared consensus sequence by 0, 1, and 2 sequenced bases. These discrepancies are tentatively ascribed to nucleotide misincorporation during the polymerase chain reaction (PCR) rather than allelic variation. One clone, here labeled vcLFY2, differed from vcLFY1 by 57 substitutions and 15 insertion/deletions. The differences between vcLFY1 and vcLFY2 were concentrated in the introns (Fig. 3B–C) with only two differences in the deduced amino acid sequence (Fig. 3A). The fifth clone was identical to vcLFY1 for most of the sequence, but the 3' end of intron II was identical to vcLFY2 (Fig. 3C). This sequence is, thus, most likely a recombinant between the other classes generated during PCR (Bradley and Hillis, 1997 ). Consequently, while at least two distinct LFY-like sequences were detected in violet cress, there is no clear evidence for more than two vcLFY genes. The probe used for in situ hybridization was composed of exon I from vcLFY1 and exon III from vcLFY2. Given the high sequence similarity in these exons the combined probe would, most likely, detect either transcript.

Gene expression
Both the LFY and vcLFY antisense probes gave a localized, reddish signal in some sections (Fig. 4). In contrast, adjacent sections hybridized to sense probes never showed any such signal (e.g., Fig. 4A-B insets). Therefore, we here interpret an accumulation of staining as representing an accumulation of LFY/vcLFY transcript.



View larger version (116K):
[in this window]
[in a new window]
 
Fig. 4. In situ hybridization results. (A–D) Longitudinal sections of violet cress (A, C, D) or Arabidopsis (B) shoot apices probed with antisense or sense probes. (A) Nine-leaf violet cress with vcLFY antisense and sense (inset) probes. Two flower primordia with subtending bract primordia are visible. (B) Twelve-leaf Arabidopsis probed with antisense or sense (inset) LFY probes. Two presumptive flower primordia visible. (C) Twelve-leaf violet cress probed with antisense vcLFY. (D) Mature (>20 leaves) violet cress probed with antisense LFY probe. (E–J) Longitudinal sections of violet cress (E–G, I–J) or Arabidopsis (H) flower primordia probed with vcLFY (E–G, I–J) or LFY (H) probes. Stages of flower development follow Smyth, Bowman, and Meyerowitz (1990). (E) Stage 1. (F) Stage 2. (G–H) Stage 3. (I) Stage 6. (J) Stage 7–8. (K) Longitudinal section of the shoot apex of a 12-leaf, GA-treated violet cress plant probed with antisense vcLFY probe

 
Expression was low or undetectable in young violet cress seedlings before the nine-leaf stage (data not shown). The first flowers produced were associated with weak but distinct vcLFY expression in the shoot apical meristem and the presumptive flower and bract primordia (Fig. 4A). Compared to Arabidopsis seedlings producing their first flower primordia (12-leaf stage; Fig. 4B), violet cress plants showed much more diffuse expression with almost as much transcript localized in the shoot apical meristem as in the flower primordium. The basic pattern of vcLFY expression across the primary shoot apex remained unchanged in older violet cress plants (Fig. 4C-D).

The changes in expression with flower stage were similar for violet cress as reported for Arabidopsis (Weigel et al., 1992 ). Flowers at stages 1–2 showed expression evenly across the apex of the primordium (Fig. 4E–F). In stage 3, both violet cress (Fig. 4G) and Arabidopsis flowers (Fig. 4H) showed transcript accumulation in the outer (calyx) whorl. In both species, older flowers showed maximal expression in developing stamens and ovaries (e.g., Fig. 4I–J).

The spatial distribution of vcLFY in GA-treated seedlings is qualitatively similar to that seen without hormone application. However, GA-treated seedlings appeared to have enhanced vcLFY expression, especially in leaves and the apical dome (compare Fig. 4C vs. K). While this effect cannot be quantified without use of a constitutively expressed control probe, it suggests that vcLFY expression is sensitive to GA levels in much the same way as LFY in Arabidopsis (Blázquez et al., 1998 ).

DISCUSSION

Molecular evolution in the LFY gene family
Two vcLFY sequence classes were detected in the violet cress genome. Without additional work, it cannot be determined conclusively whether vcLFY1 and vcLFY2 represent distinct loci or two alleles at a single locus. Nonetheless, the relatively high divergence in the introns suggests that these genes have not been subject to recombinational homogenization and that they, therefore, might represent duplicated LFY paralogs. If so, the great similarity of vcLFY1 and vcLFY2 exons to each other as compared to Arabidopsis (Fig. 3) suggests either that the gene duplication event occurred much after the divergence of Arabidopsis and violet cress or that there has been effective concerted evolution.

In considering the possibility that vcLFY1 and VCLFY2 represent distinct loci, it is necessary to evaluate whether violet cress is diploid or tetraploid. The chromosome number of violet cress is 2n = 24 (Heywood, 1992 ). Given the frequent occurrence of 2n = 12 in Cochlearia and Iberis, the putative close relatives of Jonopsidium, it is likely that violet cress has a tetraploid ancestry. Since the range of chromosome numbers within Jonopsidium is 2n = 22–36 (Luque and Lifante, 1991 ; Heywood, 1992 ) it is most plausible that tetraploidization occurred at the base of the genus. Nonetheless, although this scenario is plausible, without examining other Jonopsidium species for LFY copy number, one cannot rule out there having been a specific gene duplication event on the lineage leading to J. acaule.

The implications of the possible duplication of LFY for the evolution of rosette flowering remain uncertain. Blazquéz et al., (1997) showed that increasing LFY copy number in Arabidopsis can increase LFY expression and induce precocious flowering. However, even if violet cress has two LFY loci, this would not necessarily imply increased expression because evolutionary dosage compensation is likely. The lack of stop codons and the high sequence similarity in the vcLFY exons relative to the introns suggests that both genes are functional. However, without paralog-specific probes for in situ hybridization we do not know whether both genes are expressed in the same pattern. Therefore, further work is needed to determine the number of vcLFY paralogs and how, if at all, their expression differs.

Comparison of LFY and vcLFY expression
LFY expression in wild-type Arabidopsis was characterized by Weigel et al. (1992) using in situ hybridization. Use of a reporter construct suggested additional LFY expression in the vegetative phase (Blázquez et al., 1997 ). Similarly, immunolocalization of LFY protein showed that whereas RNA levels decline in the center of flowers at stage 3 (Fig. 4H; Weigel et al., 1992 ), protein levels persist evenly across the primordium (Parcy et al., 1998 ). Apart from these minor discrepancies, all three methods provided similar information and suggested that LFY is upregulated when Arabidopsis plants begin to flower and that the gene product accumulates in developing flower primordia. Therefore, it is reasonable to suppose that in situ hybridization in violet cress can provide useful information on the pattern of vcLFY expression during violet cress development.

In general, the pattern of vcLFY expression that we observed in violet cress is similar to that found in Arabidopsis. In both species, vcLFY signal is weak in young vegetative tissue and is much stronger in flower primordia. Young Arabidopsis leaves frequently express LFY (e.g., Blázquez et al., 1997 ) in much the same way as we have observed for vcLFY in violet cress. Flower primordia of Arabidopsis and violet cress show similar stage-specific patterns of LFY/vcLFY expression. Finally, in both species, gene expression appears to increase after the application of exogenous GA (Blázquez et al., 1997 ) and GA accelerates flowering (Blázquez et al., 1997 ; Shu et al., unpublished data). Therefore, our data suggest overall conservation in the regulation of vcLFY and LFY.

Relative to Arabidopsis, violet cress shows stronger vcLFY expression in leaves/bracts and in the shoot apical meristem (Fig. 4A–D). The presence of LFY homolog expression in bracts has been observed in other, distantly related species such as Antirrhinum (Coen et al., 1990 ) and, given the lack of bracts in Arabidopsis, this can hardly be treated as a meaningful difference. However, the presence of vcLFY transcript in the shoot apical meristem in areas that are not destined to make floral primordia is noteworthy because, in Arabidopsis, the spatial regulation of LFY expression seems to be important for normal bract suppression. Expression of LFY under the control of the more or less constitutive 35S promoter results in plants failing to suppress bracts (Weigel and Nilsson, 1995 ). In contrast, overexpression of LFY by the introduction of additional copies under the control of the endogenous LFY promoter results in early flowering, but not the production of bracts (Blázquez et al., 1997 ). These observations suggest that it is changes in the spatial or temporal pattern of expression rather than expression level per se that causes bract formation in 35S::LFY Arabidopsis. It is, therefore, a possibility that an expanded zone of vcLFY expression is the proximate cause of bract formation in violet cress.

In long-day growth conditions the number of true leaves below the first flower in violet cress is 8.1 ± 1.2 (Amaral, 1998 ). This contrasts with 18.7 ± 3.4 leaves for the inflorescence flowering Jonopsidium abulense, under the same growth conditions (Amaral, 1998 ). Furthermore, unlike J. abulense and Arabidopsis, the position of the first flower produced by violet cress is only slightly affected by daylength. Violet cress grown in short days produced 13.8% additional leaves before flowering (9.2 ± 1.3 leaves; Amaral, 1998 ), whereas short-day grown J. abulense produced 32.1% more leaves than long-day grown plants (24.7 ± 3.0 leaves; Amaral, 1998 ). Thus, the life-history strategy of violet cress seems to entail rapid commencement of reproduction regardless of environmental cues.

In principle, the evolution of precocious flowering could involve genetic changes either upstream or downstream of LFY. That is to say, it could reflect an early upregulation of LFY or it could result from flowers being formed in the absence of LFY activity. The in situ hybridization data show that the earliest flower primordia produced by violet cress express vcLFY. This suggests that precocious flowering in violet cress could arise from developmentally accelerated initiation of LFY expression, or a more rapid increase in transcript level to the threshold needed for flowering. One possible cause of precocious LFY expression is gene duplication, mirroring the effect of introducing two copies of LFY into Arabidopsis (Blázquez et al., 1997 ). Other possibilities include evolution in upstream flowering time genes or changes in the cis-regulatory elements at one or both vcLFY locus.

Conclusions and prospects
Our in situ hybridization data suggest that changes in the expression of LFY on the lineage leading to violet cress could have played a role in the evolution of early flowering (precocious expression) and bract production (diffuse expression). It should be stressed, however, that when trying to understand the genetic basis of species differences, gene expression provides only correlative evidence. Nonetheless, in situations where the genetic pathway is well understood evaluation of the expression of multiple interacting genes could help us identify the most likely cause of an interspecies difference (Kellogg, 1996 ). Therefore, it would be useful to study the expression of violet cress homologs of known regulators of LFY. For example, it would be desirable to study TERMINAL FLOWER 1 because this gene influences LFY expression and has been hypothesized to be important in inflorescence evolution (Bradley et al., 1996, 1997 ).

Notwithstanding the potential value of gene expression data, transformation experiments could bring an added level of clarity (see Baum, 1998 ). For example, if the vcLFY locus was introduced into Arabidopsis and caused precocious flowering and/or bracteate flowers, one would have good reason to suspect that vcLFY (or its cis-regulatory elements) played a direct role in the evolution of rosette flowering. Such information would not only shed light on the genetic basis of inflorescence evolution in violet cress, but could also help us to understand the general mechanisms of inflorescence development and bract suppression in Arabidopsis and other Brassicaceae.

FOOTNOTES

1 The authors thank Elena Conti, Elisa Freeman, Reto Nyffeler, and Barbara Whitlock for help in the laboratory; Melody Wu for help developing growth condition for violet cress and conducting preliminary studies of hormonal and daylength responses; Ed Seling and Lulu Le Roux for advice and assistance with SEM; Janet Sherwood for help maintaining plants; Detlef Weigel for providing clones; Fred Ausubel, Bob Pruitt, Toby Kellogg, and Detlef Weigel for useful discussion; and Michael Frohlich, Michael Purugganan, and one anonymous reviewer for comments on the manuscript. This work was funded by grants to DB from the Alfred P. Sloan Foundation, the Milton Foundation, and the Harvard University Cook Fund. Back

2 Current address: Research Center, Pioneer Hi-Bred International Inc., 7300 N.W. 62nd Ave., Johnston, Iowa 50131-1004, USA. Back

3 Current address: Forest Sciences Department, ESALQ, University of Sao Paulo, CP 9, 13418-900 Piracicaba, SP, Brazil. Back

4 Author for correspondence (e-mail: dbaum{at}oeb.harvard.edu ). Back

LITERATURE CITED

Amaral, W. A. N. 1998 Development, plasticity, and quantitative genetics of Jonopsidium acaule and Jonopsidium abulense (Brassicaceae). Ph.D. dissertation, Harvard University, Cambridge, Massachusetts, USA.

Anthony, R. G., P. E. James, and B. R. Jordan. 1993 Cloning and sequence analysis of a flo/lfy homologue isolated from cauliflower (Brassica oleracea L. var. botrytis). Plant Molecular Biology 22: 1163–1166.[CrossRef][ISI][Medline]

Baum, D. A. 1998 The evolution of plant development. Current Opinion in Plant Biology 1: 79–86.[CrossRef][ISI][Medline]

Blázquez, M. A., R. Green, O. Nilsson, M. R. Sussman, and D. Weigel. 1998 Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant Cell 10: 791–800.[Abstract/Free Full Text]

———, L. Soowal, I. Lee, and D. Weigel. 1997 LEAFY expression and flower initiation in Arabidopsis. Development 124:3835–3844.

Bradley, D., R. Carpenter, L. Copsey, C. Vincent, S. Rothstein, and E. Coen. 1996 Control of inflorescence architecture in Antirrhinum. Nature 379: 791–797.[CrossRef][Medline]

———, O. Ratcliffe, C. Vincent, R. Carpenter, and E. Coen. 1997 Inflorescence commitment and architecture in Arabidopsis. Science 275: 80–83.[Abstract/Free Full Text]

Bradley, R. D., and D. M. Hillis. 1997 Recombinant DNA sequences generated by PCR amplification. Molecular Biology and Evolution 14: 592–593.[ISI][Medline]

Busch, M. A., K. Bomblies, and D. Weigel. 1999 Activation of a floral homeotic gene in Arabidopsis. Science 285: 585–587.[Abstract/Free Full Text]

Coen, E. S., and J. M. Nugent. 1994 Evolution of flowers and inflorescences. Development 120S: 107–116.

———, J. M. Romero, S. Doyle, R. Elliott, G. F. Murphy, and R. Carpenter. 1990 floricaula: a homeotic gene required for flower development in Antirrhinum majus. Cell 63: 1311–1322.[CrossRef][ISI][Medline]

Hempel, F. D., and L. J. Feldman. 1994 Bi-directional inflorescence development in Arabidopsis thaliana: acropetal initiation of flowers and basipetal initiation of paraclades. Planta 192: 276–286.[CrossRef][ISI]

Heywood, V. H. 1992 Jonopsidium Reichenb. Flora Europaea (2nd ed.) 1: 383.

Hofer, J., L. Turner, R. Hellens, M. Ambrose, P. Matthews, A. Michael, and N. Ellis. 1997 UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current Biology 7: 581–587.[CrossRef][ISI][Medline]

Huala, E., and I. M. Sussex. 1992 LEAFY interacts with floral homeotic genes to regulate Arabidopsis floral development. Plant Cell 4:901–913.

Kellogg, E. 1996 Integrating genetics, phylogenetics and developmental biology. In B. W. S. Sobral [ed.], Impact of plant molecular genetics, 159–172. Birkhäuser, Boston, Massachusetts, USA.

Kelly, A. J., M. B. Bonnlander, and D. R. Meeks-Wagner. 1995 NFL, the tobacco homolog of FLORICAULA and LEAFY, is transcriptionally expressed in both vegetative and floral meristems. Plant Cell 7: 225–234.[Abstract]

Kyozuka, J., S. Konishi, K. Nemoto, T. Izawa, and K. Shimamoto. 1998 Downregulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proceedings of the National Academy of Sciences, USA 95: 1979–1982.[Abstract/Free Full Text]

Lee, I., D. S. Wolfe, O. Nilsson, and D. Weigel. 1997 A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Current Biology 7: 95–104.[CrossRef][ISI][Medline]

Levy, Y. Y., and C. Dean. 1998 The transition to flowering. Plant Cell 10: 1973–1989.[Free Full Text]

Luque, T., and Z. D. Lifante. 1991 Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.

Morales, R. 1993 Jonopsidium Rchb. Flora Iberica 4: 249–252.

Parcy, F., O. Nilsson, M. A. Busch, I. Lee, and D. Weigel. 1998 A genetic framework for floral patterning. Nature 395: 561–566.[CrossRef][Medline]

Pouteau, S., D. Nicholls, F. Tooke, E. Coen, and N. Battey. 1997 The induction and maintenance of flowering in Impatiens. Development 124: 3343–3351.[Abstract]

Ruiz-García, L., F. Madueño, M. Wilkinson, G. Haughn. J. Salinas, and J. M. Martínez-Zapater. 1997 Different roles of flowering-time genes in the activation of floral initiation genes in Arabidopsis. Plant Cell 9: 1921–1934.[Abstract]

Schultz, E. A., and G. W. Haughn. 1991 LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell 3: 771–781.[Abstract/Free Full Text]

Shu, G., V. Pontieri, N. G. Dengler, and L. J. Mets. 1999. Light induction of cell-type-differentiation and cell-type-specific gene expression in cotyledons of a C4 plant, Flaveria trinervia. Plant Physiology 121:731–741.

Simon, R., M. I. Igeño, and G. Coupland. 1996 Activation of floral meristem identity genes in Arabidopsis. Nature 384: 59–62.[CrossRef][Medline]

Smyth, D. R., J. L. Bowman, and E. M. Meyerowitz. 1990 Early flower development in Arabidopsis. Plant Cell 2: 755–767.[Abstract/Free Full Text]

Souer, E., A. van der Krol, D. Kloos, C. Spelt, M. Bliek, J. Mol, and R. Koes. 1998 Genetic control of branching pattern and floral identity during Petunia inflorescence development. Development 125: 733–742.[Abstract]

Wagner, D., R. W. M. Sablowski, and E. M. Meyerowitz. 1999 Transcriptional activation of APETALA1 by LEAFY. Science 285: 582–584.[Abstract/Free Full Text]

Weberling, F. 1989 Morphology of flowers and inflorescences. Cambridge University Press, Cambridge, UK.

Weigel, D. 1995 The genetics of flower development: from floral induction to ovule morphogenesis. Annual Review of Genetics 29: 19–39.[CrossRef][ISI][Medline]

———, J. Alvarez, D. R. Smyth, M. F. Yanofsky, and, E. M. Meyerowitz. 1992 LEAFY controls floral meristem identity in Arabidopsis. Cell 69: 843–859.[CrossRef][ISI][Medline]

———, and O. Nilsson. 1995 A developmental switch sufficient for flower initiation in diverse plants. Nature 377: 495–500.[CrossRef][Medline]

Yanofsky, M. 1995 Floral meristems to floral organs: genes controlling early events in Arabidopsis flower development. Annual Review of Plant Physiology and Plant Molecular Biology 46: 167–188.[CrossRef][ISI]

Zunk, K., K. Mummenhoff, M. Koch, and H. Hurka. 1996 Phylogenetic relationships of Thlapsi s.l. (subtribes Thlaspidinae, Lepideae) and allied genera based on chloroplast DNA restriction-site variation. Theoretical and Applied Genetics 92: 375–381.[CrossRef][ISI]




This article has been cited by other articles:


Home page
Am. J. Bot.Home page
J. A. Bosch, K. Heo, M. K. Sliwinski, and D. A. Baum
An exploration of LEAFY expression in independent evolutionary origins of rosette flowering in Brassicaceae
Am. J. Botany, March 1, 2008; 95(3): 286 - 293.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. E.M. Champagne, T. E. Goliber, M. F. Wojciechowski, R. W. Mei, B. T. Townsley, K. Wang, M. M. Paz, R. Geeta, and N. R. Sinha
Compound Leaf Development and Evolution in the Legumes
PLANT CELL, November 1, 2007; 19(11): 3369 - 3378.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
R. Benlloch, A. Berbel, A. Serrano-Mislata, and F. Madueno
Floral Initiation and Inflorescence Architecture: A Comparative View
Ann. Bot., September 1, 2007; 100(3): 659 - 676.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
K. Bomblies and J. F. Doebley
Molecular Evolution of FLORICAULA/LEAFY Orthologs in the Andropogoneae (Poaceae)
Mol. Biol. Evol., April 1, 2005; 22(4): 1082 - 1094.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-S. Yoon and D. A. Baum
Transgenic study of parallelism in plant morphological evolution
PNAS, April 27, 2004; 101(17): 6524 - 6529.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Bomblies, R.-L. Wang, B. A. Ambrose, R. J. Schmidt, R. B. Meeley, and J. Doebley
Duplicate FLORICAULA/LEAFY homologs zfl1 and zfl2 control inflorescence architecture and flower patterning in maize
Development, June 1, 2003; 130(11): 2385 - 2395.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. J. Carmona, P. Cubas, and J. M. Martinez-Zapater
VFL, the Grapevine FLORICAULA/LEAFY Ortholog, Is Expressed in Meristematic Regions Independently of Their Fate
Plant Physiology, September 1, 2002; 130(1): 68 - 77.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. M. Olsen, A. Womack, A. R. Garrett, J. I. Suddith, and M. D. Purugganan
Contrasting Evolutionary Forces in the Arabidopsis thaliana Floral Developmental Pathway
Genetics, April 1, 2002; 160(4): 1641 - 1650.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.
Agricola
Right arrow Articles by Shu, G.
Right arrow Articles by Baum, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS