| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Systematics |
The Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies, The New York Botanical Garden, Bronx, New York 10458-5126 USA
Received for publication September 14, 2004. Accepted for publication February 15, 2005.
ABSTRACT
Nuclear ITS and plastid matK sequences were collected for 71 taxa of Malaxideae (Orchidaceae). Resulting cladograms are highly resolved and well supported by jackknife analyses. These indicate that the traditional classification system of the tribe using characters primarily related to floral morphology does not reflect the evolutionary history of these taxa. Rather, the tribe is split into two major clades: one of terrestrial species and another of epiphytes. Within the epiphytic clade, taxa with laterally compressed leaves (Oberonia) are monophyletic, whereas the remaining taxa (Liparis pro parte) have elongate conduplicate leaves and form a paraphyletic grade of at least two additional monophyletic lineages. Within the terrestrial clade, taxa with plicate leaves (Liparis p.p. and Malaxis p.p.) clearly separate from taxa with conduplicate leaves (Liparis p.p. and Malaxis p.p.). Although further taxon sampling should take place before nomenclature is changed, it seems evident that Malaxideae will need to be divided into at least seven genera. Furthermore, the transition from epiphytic to terrestrial habit is documented to have occurred only once in Malaxideae, and the value of vegetative over reproductive features in classifying some groups of orchids is again demonstrated.
Key Words: DNA • evolution • Liparis • Malaxis • molecular • Oberonia • Orchidaceae • systematics
Malaxideae are a tribe of orchids encompassing nearly 1000 species native to both temperate and tropical areas throughout the world. In fact, the tribe is one of only a few orchid groups with a truly cosmopolitan distribution and contains two (Liparis and Malaxis) of only a handful of genera with disjunct distributions on more than one continent (Dressler, 1981
). Malaxideae are also one of the few groups of orchids that contain high numbers of both obligate terrestrial and epiphytic species (Atwood, 1986
). Morphologically, the flowers of Malaxideae are rather homogenous. They are typically very small, probably fly-pollinated, and borne on a terminal inflorescence. A single, terminal, incumbent anther usually contains four so-called "naked" pollinia (although several species do show evidence of greatly reduced caudicles and/or viscidia). Naked pollinia (i.e., devoid of accessory structures) are known from only a few other groups of higher epidendroid orchids—notably Dendrobiinae and Collabiinae. Whether or not this character is a synapomorphy for these subtribes or simply a case of homoplasy has been a matter of debate among orchid systematists. Dressler (1981
, p. 217) stated that "there is, of course, no satisfactory distinction between the Malaxideae and the Dendrobiinae, but they seem to be separate groups and probably are only very distantly related." Instead, he concurred with Lavarack (1971)
that Malaxideae are probably more closely allied to Arethuseae than to any other group of orchids. As it turns out, molecular phylogenetic studies of Orchidaceae published by Cameron et al. (1999)
and Cameron (in press)
strongly position Malaxideae as sister to Dendrobieae, far removed from either Collabiinae or Arethuseae. Thus, naked pollinia do appear to serve as a shared, derived character between these two tribes.
Within Malaxideae, the genus Oberonia is clearly distinguished from the other genera by its fan of unifacial, laterally compressed, equitant leaves, but primary variations in floral morphology used to distinguish the genera are few. For the most part, they include resupinate flowers with a long, arching column (most Liparis) vs. nonresupinate flowers with a short column (most Malaxis). Of course, differences in flower size, lip shape, and color are also diagnostic for species within each genus. On the other hand, the tribe has quite a diversity of vegetative morphology. Pseudobulbs may be present or absent, stems may have long or short internodes, and leaves are fleshy or thin, plicate or conduplicate, unifacial or bifacial, bifoliate, unifoliate, or numerous. These vegetative features have also been used in conjunction with floral characters to classify the species, but to a much lesser extent.
Given the large size of the group, its wide distribution, and its diverse morphology, considerable controversy has surrounded how best to define the genera of Malaxideae. In the strictest and most conservative sense, the tribe has been divided into at least three genera: Oberonia, Liparis, and Malaxis. Others recognize these same three core genera, but further divide the tribe into many more genera. For example, Szlachetko's (1995)
recent treatment of Orchidaceae divided Malaxideae into two subtribes (Oberoniinae and Malaxidinae) and recognized 18 genera within them; seven of these were newly described in that publication. Among the genera more commonly recognized by systematists are Orestias, Risleya, Crossoglossa, and especially Hippeophyllum (Chase et al., 2003
). For the purposes of this paper, the traditional recognition of the tribe's three main genera, Oberonia, Liparis, and Malaxis, will be employed because none of the proposed classification schemes for the tribe as a whole have been based on explicit phylogenetic information. Given this need, a molecular phylogenetic study of relationships within Malaxideae using nuclear ribosomal ITS and plastid matK sequences was initiated to gain preliminary insight regarding the monophyly of the core genera. A second goal was to assess the number of times that the terrestrial habit has evolved from presumably epiphytic ancestors within the tribe.
MATERIALS AND METHODS
Taxon sampling and gene sequencing
Complete ITS region (including ITS1, 5.8S, and ITS2) and matK sequences were obtained from 71 taxa (representing at least 59 different species) of Malaxideae. Some taxa were field collected, but the majority were obtained from ex situ living collections. Sequences of Dendrobium were downloaded from GenBank to serve as the outgroup taxon, based on the close relationship between Dendrobiinae and Malaxideae recovered in broad, family-level analyses of Orchidaceae (Cameron et al, 1999
). Complete voucher information and GenBank accession numbers are indicated in Appendix 1 (see Supplemental Data with online version of this article). The entire data matrix is available from the author upon request or can be downloaded from The New York Botanical Garden website at http://www.nybg.org/bsci/res/cullb/dna.html.
All of the sequences were produced by automated methods, briefly described as follows. Total DNA was extracted according to the manufacturer's protocols using the DNeasy (Qiagen, Valencia, California, USA) method from approximately 0.5 cm2 dried leaf tissue. Target loci were amplified in 25 µL volumes using standard polymerase chain reaction (PCR) protocols that typically included the addition of BSA and betaine (in the case of ITS). Primers designated ny43 (TATGCTTAAAYTCAGCGGGT) and ny47 (AACAAGGTTTCCGTAGGTGA) were used to amplify and sequence the ITS region. Primers ny163 (ACTTCCTCTATCCGCTACTCCTT) and ny166 (CGGATAATGTCCAAATACCAAATA) were used to amplify and sequence matK; these were complemented with two internal sequencing primers, ny164 (TTGAGCGAACACATTTTTCTATGGAA) and ny165 (ACATAATGTATGAAAGTATMTTTGA) to obtain fully overlapping double-stranded sequences. These four primers are the same as those employed by Whitten et al. (2000)
for matK sequencing of Maxillarieae. An annealing temperature of 55°C for ITS and 51°C for matK was discovered to produce the greatest quality in amplification products. In all cases, resulting PCR products were purified using QIAquick spin columns (Qiagen) according to the manufacturer's protocols. Cycle sequencing reactions were performed using a combination of purified PCR template, primer, and BigDye reaction mix (Applied Biosystems, Foster City, California, USA) for 20 cycles. To remove excess dye terminators and primer from the cycle sequencing products, Centri-Sep sephadex columns (Princeton Separations, Inc., Adelphia, New Jersey, USA) were employed. Final purified samples were subsequently dehydrated, resuspended in a mixture of formamide and loading dye, and pipetted onto a 5% denaturing polyacrylamide gel. Samples were analyzed on an Applied Biosystems ABI 377XL automated DNA sequencer, and resulting electropherograms were edited using Sequencher 3.0 software (GeneCode Corp., Ann Arbor, Michigan, USA). The complete matrix was initially aligned using ClustalX (Thompson et al., 1997
), but then adjusted manually using MacClade 4.0 (Maddison and Maddison, 2000
).
Phylogenetic analyses
The ITS, matK, and two-gene data sets were analyzed using the parsimony criterion in PAUP* version 4.0b10 (Swofford, 2002
), with gaps treated as missing data, characters weighted equally, branches collapsed if minimum length equals zero, and with DELTRAN optimization of characters onto resulting trees. Equally parsimonious trees were found by executing a heuristic search of 1000 random addition replicates using tree bisection and reconstruction (TBR) branch swapping, but keeping only five trees per replicate to discover possible "islands" of maximum parsimony (Maddison, 1991
). All trees obtained in the first round of searching were then used as starting trees for a second heuristic search using the same parameters, but this time saving all shortest trees (MULTREES option in effect). Support values for the relationships discovered by analysis of each matrix were calculated by performing jackknife (jac) analyses of 5000 heuristic search replicates using the TBR branching swapping algorithm and the following settings: 37% deletion, emulate "jac" resampling, one random addition per replicate, holding one tree, and saving two trees per replicate. Character optimizations onto the gene trees were performed using MacClade 4.0 (Maddison and Maddison, 2000
).
RESULTS
The ITS matrix contains 821 characters, of which 504 (61%) are variable and 386 (47%) are parsimony informative. Analysis of these data resulted in 240 trees of maximum parsimony (length of 1676 steps, CI of 0.505, and RI of 0.820). A single ITS tree chosen at random is presented as a phylogram in Fig. 1 to highlight variation in branch lengths, but arrows are used to show the nodes that collapse in the strict consensus of all equally parsimonious ITS trees.
|
|
|
Malaxideae have been a problem for orchid systematists concerned with establishing classification systems that reflect evolutionary history. Perhaps this is because they are mostly absent in cultivation, and therefore poorly studied, or because their flowers are so reduced that they are difficult to study. Whatever the reason, most taxonomists would agree that the traditional classification of Malaxideae into three primary genera is unsatisfactory and unnatural, but the way to better organize the tribe has not been obvious. Dressler (1981
, p. 217) stated that even "the line between Malaxis and Liparis is unclear.... There are probably groups within each ‘genus’ that are much more distantly related to each other than are the genera that we recognize in other tribes, but these cannot be delineated on the basis of our present knowledge." The results of the phylogenetic analyses presented here (especially the positions of M. spicata, Oberonia iridifolia, and L. loeselii—the type species of their respective genera; see Fig. 2) support this view. Eventually, the tribe will need to be reclassified, but it may be premature to carve Malaxideae into more genera at the present time because fewer than 10% of the tribe's species have been sampled, and the circumscription of new genera would be somewhat speculative. Substantially more taxa (especially from Africa and the Neotropics) should be sequenced before a thorough revision of this troubled tribe's taxonomy is attempted. Nevertheless, if the current well-supported pattern of species relationships continues to be recovered in larger analyses, it may be that Malaxideae can be reclassified at the genus level based first on habit and vegetative features (see later), with floral characters playing a secondary role. If this is ultimately found to be the case, it will be a remarkable exception within Orchidaceae and angiosperm taxonomy, in general, where the flower above all other organs reigns supreme.
Significance of vegetative characters
It is ironic that within a family known for its spectacular flowers and specialized floral morphology, vegetative characters are quickly gaining recognition as a better indicator of phylogenetic relationships for particular groups. This is clearly the case for Malaxideae, but has also been documented in other orchids. Three examples are Pleurothallidinae, in which particular combinations of stem, sheath, and leaf characters unite florally disparate taxa such as Scaphosepalum and Platystele into monophyletic clades (Pridgeon et al., 2001
); Oncidiinae, in which Cyrtochilum is now defined by pseudobulbs that are round in cross section and subtended by numerous long foliaceous bracts, in contrast with a large Odontoglossum clade defined by laterally compressed pseudobulbs subtended by 1–3 bracts and with 1–2 terminal leaves (Williams et al., 2001
); and Laeliinae (van den Berg et al., 2000
), in which bifoliate species of Cattleya form a clade separate from unifoliate species.
On the other hand, perhaps this irony is not so surprising because orchids are well known for their elaborate relationships with pollinators (Darwin, 1888
; Dodson, 1962
), which are capable of driving repeatedly the evolution of similar floral forms in lineages that do not necessarily share a recent common ancestor. Consider, for example, the convergent morphology of flowers from Sobralia (lower Epidendroideae), Cattleya (higher Epidendroideae), and Epistephium (Vanilloideae). Each represents a distantly related lineage of Orchidaceae, but superficially they look very much alike and probably share the same or closely related insect pollinators. Next consider that resupination in Orchidaceae has been gained and lost numerous times throughout the family (Dressler, 1981
). In addition, the degree to which a flower twists during development may be controlled by gravitropism, auxin levels, and/or a simple developmental program, possibly in harmony with genes controlling floral symmetry (Rudall and Bateman, 2004
), but undoubtedly maintained under selective pressures by pollinators. Curiously, the flowers of some Malaxis species appear to be nonresupinate, but in fact are "hyper-resupinate" in that their flowers rotate 360° (rather than 180°) during development (Ames, 1938
). Given the labile nature of the resupinate condition in Orchidaceae, it is not difficult to hypothesize that "upside-down" flowers have been gained and lost several times in Malaxideae, with column length perhaps correlated to fit specific pollinators that favor one flower orientation over the other. Darwin (1888
, p. 284) even used this argument with an example from Malaxideae in making a case for natural selection by stating, "from new sorts of insects visiting the flowers, it might be advantageous to the plant that the labellum should resume its normal position on the upper side of the flower, as is actually the case with Malaxis paludosa." As such, and in light of the gene trees presented here, an emphasis on these two superficial floral morphology characters for taxonomic purposes in Malaxideae has resulted in an unnatural system of classification.
Instead, the species of Malaxideae so neatly segregate into groups representing four distinct vegetative syndromes that one can almost predict in advance to which monophyletic clade (or paraphyletic grade) a new species will belong—even if presented with a sterile specimen. These syndromes are as follows: epiphytes with a fan of unifacial, equitant leaves; epiphytes with bifacial, linear, conduplicate leaves; terrestrials with plicate leaves; and terrestrials with 1–2, usually rounded, conduplicate leaves (see Fig. 4). Future studies with increased taxon sampling should show whether exceptions to these generalizations exist.
|
). All the epiphytic species sampled with unifacial leaves (i.e., Oberonia) form a monophyletic clade. No species of what some taxonomists recognize as the small genus Hippeophyllym were included, but this taxon might be expected to form a sister relationship with Oberonia because, although its flowers are more reminiscent of Liparis than typical Oberonia, it too has unifacial leaves. Likewise, a monophyletic clade was recovered that includes all the terrestrial species with distinctly plicate leaves. Within this plicate leafed-clade are species of Malaxis (e.g., M. taurina and M. resupinata) as well as species of Liparis (e.g., L. nervosa and L. layardii) with both resupinate and nonresupinate flowers. As shown in Fig. 3, plicate leaves are derived from conduplicate.
Terrestrial species with one or two conduplicate leaves also form a monophyletic clade, with one notable exception. Liparis laxa and its sister species L. chalandei (both endemic to New Caledonia) are a strongly supported pair positioned as sister to the entire clade of terrestrials with plicate leaves. Their relatively basal position among terrestrial taxa is intriguing because both species have several morphological features found more typically in epiphytic Liparis species. For example, L. laxa and L. chalandei produce two or occasionally three, thick, coriaceous, conduplicate leaves atop well-developed pseudobulbs, that are positioned along a creeping rhizome, which is covered in foliaceous bracts. Hallé (1977)
described the species as growing either terrestrially in loose humus or in full sun among rocks, and occasionally epiphytically on the base of tree trunks. A more detailed study into the physiology and biology of this unique lineage could help to explain the mechanisms by which such terrestrial orchids are derived from epiphytic ancestors.
Evolution of the terrestrial habit
Although Robinson and Burns-Balogh (1982)
suggested that epiphytism may have been the ancestral condition in Orchidaceae, botanists today almost universally agree that the terrestrial habit is plesiomorphic in the family and in Asparagales as a whole (Neyland and Urbatsch, 1995
). Four of the five orchid subfamilies are almost exclusively terrestrial, including the basal apostasioid, vanilloid, and cypripedioid lineages. Nearly all Orchidoideae are terrestrials, as are the tribes of "lower" Epidendroideae (e.g., Neottioideae, Triphoreae, Tropideae, and Sobralieae). Only within the "higher" Epidendroideae (which constitute ca. 80% of all orchid species) do we find entirely obligate epiphytic lineages. This habit defines ca. 88% of those genera and 92% of their species (Atwood, 1986
). In fact, Cameron (2002)
has argued that the switch from terrestrial to epiphytic lifestyle, perhaps above all others features, has been the major driving force of adaptive radiation and speciation within the family.
It is true that some species within Vanilloideae (e.g., old Vanilla vines), Cypripedioideae (e.g., Paphiopedilum parishii), and Orchidoideae (e.g., Benthamia spp.) may be facultative or even obligate epiphytes, but these are isolated cases. One does not find entire lineages of epiphytes within these subfamilies. Conversely, a handful of higher epidendroid lineages (even entire subtribes) with epiphytic ancestry have secondarily reverted to a terrestrial lifestyle. To document the number of times this has occurred within Epidendroideae is beyond the scope of this paper, but Oeceoclades, Eulophia, and Corallorhizinae are a few examples. Nearly all 300 species of Malaxis and at least 50 species of Liparis (ca. 14%) are also obligate terrestrials (Atwood, 1986
). Although the traditional classification of Malaxideae would indicate that the reversal from epiphytism to a terrestrial habit has occurred several times (see Fig. 5), that does not seem to be the case according to the molecular data presented here. Instead, it is most parsimonious to propose that the recent common ancestor of Malaxideae was an epiphyte and that only one descendent lineage came down from the trees to become fully terrestrial, whereas the remainder of the group (i.e., Oberonia and some Liparis) remained epiphytic as depicted in Fig. 1. Whether or not a similar unilateral pattern is characteristic within other higher epidendroid orchid clades remains to be investigated within the framework of robust phylogenetic hypotheses.
|
FOOTNOTES
1 Special thanks are extended to Leonid Gnatovskiy, Ken Wurdack, Alaine Ball, Joan Deutsch, and Susan Pell for their assistance with DNA extraction and gene sequencing. Chuck McCartney, Ron Coleman, Barbara Gravendeel, and others generously shared plant material and DNA samples. The Lewis B. and Dorothy Cullman Foundation provided financial support. 
2 Author for correspondence (e-mail: kcameron{at}nybg.org
)
LITERATURE CITED
Ames O. 1938 Resupination as a diagnostic character in the Orchidaceae with special reference to Malaxis monophyllos. Botanical Museum Leaflets, Harvard University 6: 145-183
Atwood J. T. 1986 The size of the Orchidaceae and the systematic distribution of epiphytic orchids. Selbyana 9: 171-186
Cameron K. M. 2002 Intertribal relationships within Orchidaceae as inferred from analyses of five plastid genes. In Abstracts of Botany 2002, Madison, Wisconsin, USA, abstract 116. Also available at website http://www.botany2002.org/section12/abstracts/33.shtml
Cameron K. M. In press Molecular systematics of Orchidaceae: a literature review and an example using five plastid genes. In H. Nair [ed.], Proceedings of the 17th World Orchid Conference. Kuala Lumpur, Malaysia, 2004,
Cameron K. M. Chase M. Whitten P. Kores D. Jarrell V. Albert T. Yukawa H. Hills D. Goldman 1999 A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208-224
Chase M. W. J. F. Freudenstein K. M. Cameron 2003 DNA data and Orchidaceae systematics: a new phylogenetic classification. In K. W. Dixon, S. P. Kell, R. L. Barrett, and P. J. Cribb [eds.], Orchid conservation, 69–89. Natural History Publications, Kota Kinabalu, Sabah, Malaysia
Darwin C. 1888 The various contrivances by which orchids are fertilised by insects, 2nd ed. John Murray, London, UK
Dodson C. 1962 The importance of pollination in the evolution of the orchids of tropical America. American Orchid Society Bulletin 31: 525-554
Dressler R. L. 1981 The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts, USA
Hallé N. 1977 Orchidacees. In A. Aubreville and J.-F. Leroy [eds.], Flore de la Nouvelle Caledonie et Dependances, vol. 8. Museum National D'Histoire Naturelle, Paris, France
Lavarack P. S. 1971 The taxonomic affinities of the Neottioideae. Ph.D. thesis, University of Queensland, Brisbane, Australia
Maddison D. 1991 The discovery and importance of multiple islands of most-parsimonious trees. Systematic Zoology 40: 315-328[CrossRef]
Maddison D. W. Maddison 2000 MacClade 4.0. Sinauer Associates, Sunderland, Massachusetts, USA
Neyland R. L. Urbatsch 1995 A terrestrial origin for the Orchidaceae suggested by a phylogeny inferred from ndhF chloroplast gene sequences. Lindleyana 10: 244-251
Pridgeon A. M. R. Solano M. W. Chase 2001 Phylogenetic relationships in Pleurothallidinae (Orchidaceae): combined evidence from nuclear and plastid DNA sequences. American Journal of Botany 88: 2286-2308
Robinson H. P. Burns-Balogh 1982 Evidence for a primitively epiphytic habit in Orchidaceae. Systematic Botany 7: 353-358[CrossRef][ISI]
Rudall P. J. R. M. Bateman 2004 Evolution of zygomorphy in monocot flowers: iterative patterns and developmental constraints. New Phytologist 162: 25-44[CrossRef][ISI]
Swofford D. L. 2002 PAUP* 4.0b10: phylogenetic analysis using parsimony (* and other methods). Sinauer Associates, Sunderland, Massachusetts, USA
Szlachetko D. L. 1995 Systema Orchidalium. Fragmenta Foristica et Geobotanica Supplementum 3: 1-152
Szlachetko D. L. H. B. Margoñska 2004 Disticholiparis Marg. & Szlach. Eine neue Gattung der Subtribus Malaxidinae [a new genus of the subtribe Malaxidinae]. Die Orchidee 55: 178
Thompson J. D. T. J. Gibson F. Plewniak F. Jeanmougin D. G. Higgins 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882
van den Berg C. W. E. Higgins R. L. Dressler W. M. Whitten M. A. Soto Arenas A. Culham M. W. Chase 2000 A phylogenetic analysis of Laeliinae (Orchidaceae) based on sequence data from internal transcribed spacers (ITS) of nuclear ribosomal DNA. Lindleyana 15: 96-114
Whitten W. M. N. H. Williams M. W. Chase 2000 Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on Stanhopeinae: combined molecular evidence. American Journal of Botany 87: 1842-1856
Williams N. H. M. W. Chase T. Fulcher W. M. Whitten 2001 Molecular systematics of the Oncidiinae based on evidence from four DNA sequence regions: expanded circumscriptions of Cyrtochilum, Erycina, Otoglossum, and Trichocentrum and a new genus (Orchidaceae). Lindleyana 16: 113-139
This article has been cited by other articles:
|
|
 |
|
  M. M. Barthet and K. W. Hilu Expression of matK: functional and evolutionary implications Am. J. Botany, August 1, 2007; 94(8): 1402 - 1412. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
